CMarZ Barcoding Association
Protocol for DNA extraction, amplification and sequencing of Zooplankton
1. DNA Extraction
After specimen identification, DNA is extracted with the Qiagen DNeasy Tissue Kit using the Animal Tissue Protocol included with the kits manual. DNA is eluted in final step with 50μl for specimens < 1mm, 100uL for 1-3 mm and 200μL for >3 mm.
[69504 DNeasy Tissue Kit, Qiagen Inc. (Valencia, CA)] www.qiagen.com
2. PCR Reaction Conditions
Reagent |
Volume/ Concentration |
5 x Buffer |
10 µL |
MgCl2 (25 mM) |
2-8 µL |
dNTPs (2 mM each) |
2-5 µL |
Forward primer (10 µM) |
0.5-1 µL |
Reverse Primer (10 µM) |
0.5-1 µL |
Taq Polymerase |
0.25 µL |
Sterile water |
X µL |
Sample DNA |
5-50 ng |
Total |
50 uL |
Add a negative control with water instead of sample DNA. It is also helpful to add a positive control sample that has been successfully amplified in the past. *Note: Reagent concentrations may need to be optimized for tissue type, DNA quality and thermal cycler used.
Primer sequences from Folmer et al. (1994)
LCO1490: 5'- GGTCAACAAATCATAAAGATATTGG -3'
HCO2198: 5'- TAAACTTCAGGGTGACCAAAAAATCA -3'
[M8295 GoTaq Flexi DNA Polymerase, Promega Corporation (Madison, WI)]
3. Thermal Cycling Conditions
An example of a typical cycling protocol:
94°C 2:00min , initial denaturation
35 cycles of 94°C 0:40 min, 45°C 0:45 min, 72°C 1:00 min
72°C 7:00 min, final extension
4°C hold
Results will vary among PCR machines; conditions should be optimized for each machine. For mismatched primers, our best results have been obtained using a Perkin Elmer 480 DNA Thermal Cycler, an older - and more slowly-ramping - PCR machine. Our standard cycling protocol for this machine is: 94°C (1 min); 45°C (2 min); 72°C (3 min) for 40 cycles.
Check PCR with agarose gel electrophoresis and appropriate size quantification ladder. PCR should yield a 710 bp fragment
4. PCR reaction cleanup
PCR reactions can be cleaned using commercially available kits to remove excess primer, dNTP, and Taq. Examples of kits we have used are the QIAquick PCR Purification Kit and the MoBio UltraClean™ PCR Clean-Up kit.
[28106 Qiagen QIAquick PCR purification Kit, Qiagen Inc. (Valencia, CA) www.qiagen.com and 12500 MoBio UltraClean™ PCR Clean-Up www.mobio.com]
5. Cycle Sequencing Reaction:
Example 1/4 Reactions:
Reagent |
Volume (µL) per reaction |
BigDye v3.1 |
2 |
BigDye Buffer |
1 |
Primer (10uM) |
0.2 |
Water |
X |
Template |
5-20 ng |
Total |
10 |
Example 1/8 Reactions:
Reagent |
Volume (µL) per reaction |
BigDye v3.1 |
1 |
BigDye Buffer |
0.5 |
Primer (10uM) |
0.2 |
Water |
X |
Template |
5-20 ng |
Total |
6 |
[4337455 BigDye Terminator v3.1 Cycle Sequencing Kit, Applied Biosystems (Foster City, CA) www.appliedbiosystems.com]
6. Cycle Sequencing Thermal Cycling Conditions:
96°C 1:00, initial denaturation
25 cycles: 96°C 0:10 min, 50°C 0:05 min, 60°C 4:00 min
4°C hold
7. Ethanol /EDTA/ Sodium Acetate precipitation:
-Add 1 µL of 250mM EDTA to each cycle sequencing reaction and mix.
-Prepare an ethanol/ sodium acetate master mix by combining the following for each reaction:
1 µL 3 M sodium acetate, pH 4.6
23 µL nondenatured 95% ethanol
1 µL deionized water
-Add 25 µL of the master mix to each reaction.
-Seal plate adhesive film and mix by inverting the plate a few times or by briefly vortexing.
-Leave the reaction plate at room temperature for at least 15 minutes (no longer than 24 hrs).
-Place plate in a centrifuge with plate adaptor and spin at 3000 x g for 30 minutes.
-Immediately after centrifuge stops, pour out supernatant, being careful to not disturb the pellet, and invert plate onto a folded paper towel. Place inverted plate on paper towel into centrifuge and spin at 20 x g for 1 minute.
-Add 35 µL of nondenatured 70% ethanol to each reaction.
-Seal plate with adhesive film and mix by inverting or briefly vortexing. Place plate in centrifuge and spin at 3000 x g for 10 minutes.
-Immediately after centrifuge stops, pour out supernatant, being careful to not disturb the pellet, and invert plate onto a folded paper towel. Place inverted plate on paper towel into centrifuge and spin at 20 x g for 1 minute.
- Dry samples by placing in a speed-vac for 15 minutes or drying at room temperature for 1 hour.
*Note: BigDye degrades with light exposure, try to protect reactions from light as much as possible.